Review



sequences aaactcccgtgcttgtgctgagtgc  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc sequences aaactcccgtgcttgtgctgagtgc
    Sequences Aaactcccgtgcttgtgctgagtgc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 2743 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+digested+px459/pm41683574-279-14-19?v=Addgene+inc
    Average 96 stars, based on 2743 article reviews
    sequences aaactcccgtgcttgtgctgagtgc - by Bioz Stars, 2026-08
    96/100 stars

    Images



    Similar Products

    96
    Addgene inc sequences aaactcccgtgcttgtgctgagtgc
    Sequences Aaactcccgtgcttgtgctgagtgc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+digested+px459/pm41683574-279-14-19?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    sequences aaactcccgtgcttgtgctgagtgc - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    96
    Addgene inc bbsi digested pspcas9 bb 2a puro
    Bbsi Digested Pspcas9 Bb 2a Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+digested+px459/pmc12929130-56-16-20?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    bbsi digested pspcas9 bb 2a puro - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    96
    Addgene inc bbsi digested px459
    Bbsi Digested Px459, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+digested+px459/pmc12926204-37-0-3?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    bbsi digested px459 - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    96
    Addgene inc paper n a recombinant dna bbsi digested px459 addgene plasmid
    Paper N A Recombinant Dna Bbsi Digested Px459 Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+digested+px459/pm41338219-229-171-177?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    paper n a recombinant dna bbsi digested px459 addgene plasmid - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    96
    Addgene inc bbsi digested pspcas9 bb 2a puro plasmid
    Bbsi Digested Pspcas9 Bb 2a Puro Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+digested+px459/bio_rxiv__2025__11__10__687614-208-6-10?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    bbsi digested pspcas9 bb 2a puro plasmid - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    96
    Addgene inc bbsi digestion into pspcas9 bb 2a puro
    Bbsi Digestion Into Pspcas9 Bb 2a Puro, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/bbsi+digested+px459/pm40643555-141-17-22?v=Addgene+inc
    Average 96 stars, based on 1 article reviews
    bbsi digestion into pspcas9 bb 2a puro - by Bioz Stars, 2026-08
    96/100 stars
      Buy from Supplier

    Image Search Results